Adenoviral Bid overexpression induces caspase-dependent cleavage of truncated Bid and p53-independent apoptosis in human non-small cell lung cancers

Proapoptotic gene transfer to promote death or to augment killing by DNA-damaging agents represents a promising strategy for cancer therapy. We have constructed an adenoviral Tet-Off trade mark vector with tightly controlled expression of Bid (Ad-Bid) (Clontech, Palo Alto, CA). Using the non-small cell lung cancer cell lines H460, H358, and A549, low dose Ad-Bid was shown to induce high levels of full-length Bid as well as caspase-3 and -9 activity. Although only a small fraction of Bid was processed to truncated Bid (a step inhibited by benzyloxycarbonyl-Val-Ala-Asp-fluoromethyl ketone), Ad-Bid gene transfer resulted in mitochondrial changes consistent with apoptosis (mitochondrial depolarization, cytochrome c release), DNA fragmentation, and a dramatic loss of cell viability. The proapoptotic effects of Ad-Bid were independent of p53 status and were augmented markedly by caspase-8 activators such as the DNA-damaging agent cisplatin. When Ad-Bid and cisplatin were used together, chemosensitivity was restored in p53-null H358 cells, increasing death from 35% following treatment with cisplatin and Ad-LacZ to >90% death with Ad-Bid and cisplatin (Ad-Bid alone induced 50% cell death under these conditions). Ad-Bid can induce apoptosis in malignant cells and enhance chemosensitivity in the absence of p53, suggesting this approach as a potential cancer therapy.     

Cloning and characterization of a novel RING-B-box-coiled-coil protein with apoptotic function

We have identified a novel RING-B-box-coiled-coil (RBCC) protein (MAIR for macrophage-derived apoptosis-inducing RBCC protein) that consists of an N-terminal RING finger, followed by a B-box zinc finger, a coiled-coil domain, and a B30.2 domain. MAIR mRNA was expressed widely in mouse tissues and was induced by macrophage colony-stimulating factor in murine peritoneal and bone marrow macrophages. MAIR protein initially showed a granular distribution predominantly in the cytoplasm. The addition of zinc to transfectants containing MAIR cDNA as part of a heavy metal-inducible vector caused apoptosis of the cells characterized by cell fragmentation; a reduction in mitochondrial membrane potential; activation of caspase-7, -8, and -9, but not caspase-3; and DNA degradation. We also found that the RING finger and coiled-coil domains were required for MAIR activity by analysis with deletion mutants.     

A novel hematopoietic adaptor protein,Chat-H,positively regulates T cell receptor-mediated interleukin-2 production by Jurkat cells

Chat (Cas/HEF1-associated signal transducer) is a novel adaptor protein with an N-terminal Src homology-2 domain and C-terminal Cas/HEF1 association domain. We report here the molecular cloning of Chat-H, the hematopoietic isoform of Chat. Chat-H has an extended N-terminal domain besides the known Chat domain structures, suggesting a unique function of Chat-H in hematopoietic cells. Jurkat transfectants overexpressing Chat-H show a marked increase in interleukin-2 production after costimulation of T cell receptor and CD28. The degree of JNK activation is enhanced substantially in the Chat-H transfectants upon costimulation. The Src homology-2 domain mutant of Chat-H loses this signal modulating activity. Expression of the Cas/HEF1 association domain mutant exhibits a dominant negative effect on both JNK activation and interleukin-2 production. We further found that Chat-H forms a complex with Pyk2H and enhances its tyrosine 402 phosphorylation, an up-regulator of the JNK pathway. These results suggest that Chat-H positively controls T cell function via integrating the costimulatory signals.     

A molecular marker diagnostic of a specific isolate of an arbuscular mycorrhizal fungus,Gigaspora margarita

To investigate the auto-ecology of a strain of Gigaspora margarita in a commercial inoculum, we found a pair of PCR primers amplifying a sequence of 235 bp diagnostic of the isolate. We designed an oligonucleotide probe based on the DNA sequence. The combination of PCR and the probing successfully detected the diagnostic sequence from both DNA preparations of single spores and colonized roots. This protocol enabled us to distinguish the isolate among several isolates from Japan, Nepal and the USA.     

Phosphorylation of neuroglycan C, a brain-specific transmembrane chondroitin sulfate proteoglycan, and its localization in the lipid rafts

Neuroglycan C (NGC) is a brain-specific transmembrane chondroitin sulfate proteoglycan. In the present study, we examined whether NGC could be phosphorylated in neural cells. On metabolic labeling of cultured cerebral cortical cells from the rat fetus with (32)P(i), serine residues in NGC were radiolabeled. Some NGC became detectable in the raft fraction from the rat cerebrum, a signaling microdomain of the plasma membrane, with cerebral development. NGC from the non-raft fraction, not the raft fraction, could be phosphorylated by an in vitro kinase reaction. The phosphorylation of NGC was inhibited by adding to the reaction mixture a recombinant peptide representing the ectodomain of NGC, but not by adding a peptide representing its cytoplasmic domain. NGC could be labeled by an in vitro kinase reaction using [gamma-(32)P]GTP as well as [gamma-(32)P]ATP, and this kinase activity was partially inhibited by 5,6-dichloro-1-beta-d-ribofuranosylbenzimidazole, a selective inhibitor of casein kinase II. In addition to the intracellular phosphorylation, NGC was also phosphorylated at the cell surface by an ectoprotein kinase. This is the first report to demonstrate that NGC can be phosphorylated both intracellularly and pericellularly, and our findings suggest that a kinase with a specificity similar to that of casein kinase II is responsible for the NGC ectodomain phosphorylation.     

Analysis of dofA,a fruA-dependent developmental gene,and its homologue,dofB, in Myxococcus xanthus

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.     

barS1, a gene for biosynthesis of a gamma-butyrolactone autoregulator,a microbial signaling molecule eliciting antibiotic production in Streptomyces species

From Streptomyces virginiae, in which production of streptogramin antibiotic virginiamycin M(1) and S is tightly regulated by a low-molecular-weight Streptomyces hormone called virginiae butanolide (VB), which is a member of the gamma-butyrolactone autoregulators, the hormone biosynthetic gene (barS1) was cloned and characterized by heterologous expression in Escherichia coli and by gene disruption in S. virginiae. The barS1 gene (a 774-bp open reading frame encoding a 257-amino-acid protein [M(r), 27,095]) is situated in the 10-kb regulator island surrounding the VB-specific receptor gene, barA. The deduced BarS1 protein is weakly homologous to beta-ketoacyl-acyl carrier protein/coenzyme A reductase and belongs to the superfamily of short-chain alcohol dehydrogenase. The function of the BarS1 protein in VB biosynthesis was confirmed by BarS1-dependent in vitro conversion of 6-dehydro-VB-A to VB-A, the last catalytic step in VB biosynthesis. Of the four possible enantiomeric products from racemic 6-dehydro-VB-A as a substrate, only the natural enantiomer of (2R,3R,6S)-VB-A was produced by the purified recombinant BarS1 (rBarS1), indicating that rBarS1 is the stereospecific reductase recognizing (3R)-isomer as a substrate and reducing it stereospecifically to the (6S) product. In the DeltabarS1 mutant created by homologous recombination, the production of VB as well as the production of virginiamycin was lost. The production of virginiamycin by the DeltabarS1 mutant was fully recovered by the external addition of VB to the culture, which indicates that the barS1 gene is essential in the biosynthesis of the autoregulator VBs in S. virginiae and that the failure of virginiamycin production was a result of the loss of VB production.     

Identification by heterologous expression and gene disruption of VisA as L-lysine 2-aminotransferase essential for virginiamycin S biosynthesis in Streptomyces virginiae

The visA gene of Streptomyces virginiae has been thought to be a part of the virginiamycin S (VS) biosynthetic gene cluster based on its location in the middle of genes that encode enzymes highly similar to those participating in the biosynthesis of streptogramin-type antibiotics. Heterologous expression of the visA gene was achieved in Escherichia coli by an N-terminal fusion with thioredoxin (TrxA), and the intact recombinant VisA protein (rVisA) was purified after cleavage with enterokinase to remove the TrxA moiety. The purified rVisA showed clear L-lysine 2-aminotransferase activity with an optimum pH of around 8.0 and an optimum temperature at 35 degrees C, with 2-oxohexanoate as the best amino acceptor, indicating that VisA converts L-lysine into Delta(1)-piperidine 2-carboxylic acid. A visA deletion mutant of S. virginiae was created by homologous recombination, and the in vivo function of the visA gene was studied by phenotypic comparison between the wild type and the visA deletion mutant. No differences in growth in liquid media or in morphological behavior on solid media were observed, indicating that visA is not involved in primary metabolism or morphological differentiation. However, the visA mutant failed to produce VS while maintaining the production of virginiamycin M(1) at a level comparable to that of the parental wild-type strain, demonstrating that visA is essential to VS biosynthesis. These results, together with the observed recovery of the defect in VS production by the external addition of 3-hydroxypicolinic acid (3-HPA), a starter molecule in VS biosynthesis, suggest that VisA is the first enzyme of the VS biosynthetic pathway and that it supplies 3-HPA from L-lysine.